Supplementary Table 1. Mouse Primers/probes used in TaqMan real-time PCR. Gene Gene Assay ID number/Primer sequences (5´ to 3´
cAMP-responsive Element-binding Protein (CREB) and cAMP Co-regulate Activator Protein 1 (AP1)-dependent Regeneration-associated Gene Expression and Neurite Growth* - Journal of Biological Chemistry
Applied Biosystems™ Mouse GAPD (GAPDH) Endogenous Control (VIC™/MGB probe, primer limited) 2500 reacciones Ver productos | Fisher Scientific
Mouse Positive Control Primer Set Gapdh-2 – MyBio Ireland
Characterization and Identification of Subpopulations of Mononuclear Preosteoclasts Induced by TNF-α in Combination with TGF-β in Rats | PLOS ONE
Human-specific GAPDH qRT-PCR is an accurate and sensitive method of xenograft metastasis quantification - ScienceDirect
Human GAPDH qPCR Primer Pair, HP100003 | Sino Biological
Human-specific GAPDH RT-qPCR is an accurate and sensitive method of xenograft metastasis quantification | bioRxiv
The primer set used for the amplification of mouse GAPDH, P21 and P53. | Download Table
primer set Forward Reverse Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA Arid1a GACCCCTCAGTCATCCAGTC GAGTATGGGTTAGTCCCACCA
Sequence of primers for mouse leptin, leptin receptors and GAPDH. | Download Table
Primer sequences of target genes and GAPDH for real-time PCR assay | Download Scientific Diagram
Primers used for RT-PCR. Primer specificity to human (H), mouse (M),... | Download Table
![PDF] EF1α is a suitable housekeeping gene for RT-qPCR analysis during osteogenic differentiation of mouse bone marrow-derived mesenchymal stem cells. | Semantic Scholar](https://d3i71xaburhd42.cloudfront.net/c77d99d78b94b1411dd6ea6164da800e9c1a4a23/2-Table1-1.png "PDF] EF1α is a suitable housekeeping gene for RT-qPCR analysis during osteogenic differentiation of mouse bone marrow-derived mesenchymal stem cells. | Semantic Scholar")
PDF] EF1α is a suitable housekeeping gene for RT-qPCR analysis during osteogenic differentiation of mouse bone marrow-derived mesenchymal stem cells. | Semantic Scholar
Mouse/Rat Pluripotent Primer Pair Panel (SC015): R&D Systems
Amplifluor Human/Mouse GAPDH Primer Set (Texas Red labeled)
Human-specific GAPDH qRT-PCR is an accurate and sensitive method of xenograft metastasis quantification: Molecular Therapy Methods & Clinical Development
SciELO - Brasil - Extracellular calcium increases fibroblast growth factor 2 gene expression via extracellular signal-regulated kinase 1/2 and protein kinase A signaling in mouse dental papilla cells Extracellular calcium increases fibroblast
Primer sequences for mouse DNMT genes and Gapdh. | Download Table
Primer sequences used for RT-PCR in mouse | Download Table
Importance of Suitable Reference Gene Selection for Quantitative RT-PCR during ATDC5 Cells Chondrocyte Differentiation | PLOS ONE
MP205604 | Gapdh Mouse qPCR Primer Pair (NM_008084) Clinisciences
xmlinkhub
Suitable primers for GAPDH reference gene amplification in quantitative RT-PCR analysis of human gene expression - ScienceDirect
JCI - TDP-43 regulates early-phase insulin secretion via CaV1.2-mediated exocytosis in islets
Primer sequences for GAPDH, p53 and p16 mouse cDNAs. | Download Table
Evaluation of stable reference genes for qPCR normalization in circadian studies related to lung inflammation and injury in mouse model | Scientific Reports
Differentiation of Human Embryonic Stem Cells into Cells with Corneal Keratocyte Phenotype | PLOS ONE
